Skip to main content
Download PDF

Apigenin reduces the suppressive effect of exosomes derived from irritable bowel syndrome patients on the autophagy of human colon epithelial cells by promoting ATG14

World Journal of Surgical Oncology volume 21, Article number: 95 (2023) Cite this article

Abstract

Background

Inflammatory bowel disease (IBS) is a chronic disorder of the gastrointestinal tract. Exosomes have been involved in various pathological processes including IBS. Apigenin has been reported to suppress inflammatory bowel disease (IBS). However, the regulatory roles of exosomes derived from IBS patients (IBS-exos) on human colon epithelial cells are still unclear.

Methods

Exosomes were collected from IBS patients (IBS-exos) and co-cultured with CACO-2 cells. Apigenin was used to treat IBS-exos-treated CACO-2 cells. By exploring the public data bank, we figured out the regulators control the autophagy of CACO-2 cells.

Results

Administration of apigenin dose-dependently abolished the inhibitory effect of IBS-exo on the autophagy of CACO-2 cells. A mechanistic study showed that miR-148b-3p bound to 3′UTR to suppress ATG14 and decrease autophagy. Moreover, results suggested that ATG14 overexpression promoted the autophagy of CACO-2 cells in the presence of miR-148b-3p mimic.

Conclusion

The current study showed that apigenin dose-dependently abolished the inhibitory effect of IBS-exo on CACO-2 cell autophagy by regulating miR-148b-3p/ATG14 signaling.

Introduction

Irritable bowel syndrome (IBS) is characterized by abdominal pain and alterations in bowel habits [1]. The prevalence rates of IBS in the USA and Canada are reported as about 12% [2]. Studies have indicated that IBS patients have a poor life quality and heavily use the health care system [3, 4].

Apigenin, one of the most studied phenolics, is present principally as glycosylated in significant amount in vegetables, fruits, and herbs [5]. Apigenin has been used as an antioxidant and anti-inflammatory [6, 7]. Apigenin was also reported to suppress various human cancers [8]. A recent study also demonstrated that apigenin is involved in anti-inflammation and autophagy and suppresses IBS [9, 10]. However, the role of apigenin in the autophagy of human colon epithelial cells is unclear.

Exosomes, 30–120-nm membrane-derived vesicles containing DNAs, mRNAs, microRNAs, or proteins, participate in cell communication and protein/RNA delivery [11, 12]. Exosomes have been shown to be secreted by a broad spectrum of cells and regulate the pathological development of numerous diseases [13, 14]. For example, exosomes secreted by mesenchymal stem cell (MSC) reduce myocardial ischemia/reperfusion injury [15]. Gallet et al. have shown that cardiosphere-derived cell-secreted exosomes reduce scarring and alleviate myocardial infarction [16]. Irritable bowel syndrome (IBS) is a chronic disorder of the intestines [1]. However, the regulatory relationship between exosomes derived from IBS patients (IBS-exos) and human colon epithelial cells is still unclear.

Autophagy is a cell survival mechanism which adapts cells to metabolic stresses [17]. Autophagy plays an important role in different cellular processes [18, 19]. Studies also demonstrated that autophagy plays a protective role against some human diseases, and autophagy dysfunction has previously been associated with a variety of diseases including cancer, neurodegeneration, and IBS [18, 20,21,22]. Studies also indicated that intestinal epithelial cells constitute the first physical barrier to protect the intestinal mucosa from injury, and the activation of intestinal epithelial cell autophagy is essential to maintain intestine function [23, 24]. However, the relationship between IBS-exos and the autophagy of human colon epithelial cells remains to be elucidated.

miR-148b-3p involves in different biological processes including autophagy and apoptosis. For instance, overexpressing miR-148b-3p down-regulated the viability, but increased the apoptosis of hypoxia/reoxygenation-treated cardiomyocytes [25]. A study also indicated that miR-148b-3p regulated pancreatic autophagy via suppression of autophagy elated 12 (ATG12) [26]. miR-148a has been shown to regulate autophagy by down-regulating IL-6/STAT3 signaling [27]. However, the function of miR-148b-3p in the autophagy of human colon epithelial cells is largely unknown.

Autophagy-related 14 (ATG14) play a very important role in autophagy by directing Complex I to function in autophagy by regulating its localization [28]. Xiong et al. have shown that ATG14 plays a critical role in hepatic autophagy and lipid metabolism [29]. Diao et al. indicated that ATG14 enhances membrane tethering and fusion of autophagosomes to endolysosomes [30]. But the role of ATG14 in the autophagy of human colon epithelial cells is rarely studied.

This study aims to explore the relationship between IBS-exos and autophagy of human colon epithelial cells, and the effect of apigenin on autophagy in human colon epithelial cells, therefore providing data for a better understanding of the role of apigenin in autophagy and IBS.

Materials and methods

Human blood

The study was approved by the Ethics Committee of Tongde Hospital of Zhejiang Province. Fifteen blood samples of IBS patients diagnosed according to Rome III criteria or controls were used to isolate exosomes. Written informed consent was received.

Cell culture

CACO-2 cells were purchased from Shanghai Biology Institute and maintained in DMEM (Gibco, Carlsbad, CA, USA) with 10% FBS (Gibco) in an incubator at 37°C plus 5% CO2 atmosphere.

Isolation and characterization of exosomes

Exosome in serum was collected as described previously [31]. Briefly, the serums were initially centrifuged at 3000 g for 15 min, to remove cells and other debris, and then the supernatants were span at 10000 g for 20 min to remove shedding vesicles and other vesicles that were larger than exosomes. Finally, the supernatants were span at 100,000 g for 1h at 4°C. Pellets were re-suspended in PBS and characterized by transmission electron microscopy (TEM) and immuno-staining.

Exosome uptake analysis

Exosomes were stained by green fluorescent linker PKH67 (UR52303, Umibio, Shanghai, China). One milliliter of exosomes (1 μg/mL) was incubated with 2 μL PKH67 for 25 min at room temperature. In order to bind excess dye, 2 mL of 0.5% BSA/PBS was added. The labeled exosomes were washed at 100,000 g for 1 h, and the exosome pellet was suspended with PBS and used for uptake experiments. CACO-2 cells were seeded (50,000/well) and treated by medium with/without PKH67-labeled exosomes for 24 h. DAPI was used to stain the nucleus. Uptaking was observed under a fluorescence microscope (Leica Microsystems, Wetzlar, Germany).

qRT-PCR

RNA was isolated and reverse transcribed into cDNA (Invitrogen, Waltham, MA, USA). Q-PCR was done using the SYBR Green qPCR Master Mixes (Thermo Fisher, Rockford, IL, USA) as follows: 95°C for 10 min followed by 40 cycles of 95°C for 15 s and 60°C for 45 s. U6 or β-actin was used as control. The gene relative expression was calculated by the 2−ΔΔCt formula. The primers were as follows (5′-3′):

  • has-miR-148b-3p, F: CGCGTCAGTGCATCACAGAA, R: AGTGCAGGGTCCGAGGTATT;

  • U6, F: CTCGCTTCGGCAGCACA, R: AACGCTTCACGAATTTGCGT.

  • ATG14, F: TCATTATGAGCGTCTGGC, R: ATGCTGGTGTCTCCGTTG;

  • β-actin, F: AATGCCTTCACGATGTTC, R: AGCCTGCTGTAATATTGC.

Immunoblotting

Protein was isolated using RIPA lysis buffer (JRDUN, Shanghai, P.R. China), concentration-measured by an enhanced BCA protein assay kit (Thermo Fisher Scientific), separated by 10% SDS-PAGE, and immunoblotted to PVDF membranes (Millipore, Billerica, MA, USA), blocked with 5% nonfat dry milk for 1 h at room temperature, and probed with primary antibodies at 4°C overnight. After washing with PBST, the bolts were incubated with a second antibody for 1 h at 37°C. An enhanced chemiluminescence system (Tanon, Shanghai, P.R. China) was used to visualize protein. Primary antibodies’ information was provided as follows: CD9 (Ab92726, Abcam, St. Louis, MO, USA), CD81 (Ab109201, Abcam), ATG14 (Ab227849, Abcam), and GAPDH (60004-1-1G, Proteintech, UK).

Overexpression of ATG14

The pLVX-puro containing ATG14 (ovTAG14) or vector (ovNC) alone were purchased from Genechem company (Shanghai, China). CACO-2 cells were transfected with the plasmids using Lipo2000, and the cells were analyzed 48 h after transfection.

Immunofluorescent staining

To evaluate the expression of autophagy markers LC3, cells were fixed, blocked, and probed with anti-LC3 antibody overnight at 4°C. Cells were washed and incubated in fluorochrome-conjugated secondary antibody for 1 h in the dark. Nuclei were counterstained by 4′,6-diamidino-2-phenylindole, dihydrochloride (DAPI), and cells were observed under a fluorescent microscope.

Dual-luciferase reporter gene assay

Binding sites of miR-148b-3p and ATG14 were predicted by TargetScan. According to the prediction, wild type and mut sequences were synthesized respectively and cloned to luciferase reporter vectors (pGL3-Basic). Then, WT 3′ UTR or Mut 3′UTR plasmid was co-transfected with miR-148b-3p inhibitor or mimics into CACO-2 cells. After 48 h of transfection, a dual-luciferase reporter gene kit (Beijing Yuanpinghao Biotechnology Co., Ltd.) was used to determine the luciferase activity of cells in each group.

Statistical analysis

Prism7.0 (La Jolla, CA) was used to analyze the data. Data was expressed as mean ± SD. Comparisons were performed by T-test or one-way ANOVA with Tukey’s post hoc test. P values less than 0.05 were considered as significant.

Results

Isolation and identification of exosomes

We collected serum samples from IBS patients and controls to extract exosomes. Exosomes from IBS patients (IBS-exo) or controls (control-exo) are shown in Fig. 1A. Immunoblotting further confirmed the expression of markers CD9 and CD81 (Fig. 1B). Co-culture assay showed that exosomes were up-taken by CACO-2 cells (Fig. 1C). This laid the foundation of this study.

Fig. 1
figure 1

Isolation and characterization of exosomes. A Exosome morphology. B Western blotting detection of exosome markers, CD9 and CD81. ***p < 0.001 vs vehicle; !!!p < 0.001 vs oeNC + IBS-exo. C Uptake of exosomes by human colon epithelial Caco-2 cells was determined using PKH-67 dye

Full size image

Exosome from IBS patients decreased the autophagy in CACO-2 cells

We next examined the effect of exosomes on autophagy of CACO-2, using LC3 as a maker of autophagy. Data revealed that co-culture with IBS-exos reduced autophagy in CACO-2 cells, compared to controls (Fig. 2).

Fig. 2
figure 2

The autophagy of CACO-2 cells was decreased after co-cultured with IBS-exo. IMF staining examination of the effect of IBS-exo on CACO-2 autophagy

Full size image

Apigenin dose-dependently abolished the inhibitory effect of IBS-exo on CACO-2 autophagy

In order to know whether apigenin affects CACO-2 autophagy, IMF staining was performed. Results suggested that apigenin dose-dependently abolished the inhibitory effect of IBS-exo CACO-2 autophagy (Fig. 3A, B). Western blotting showed that apigenin dose-dependently diminished IBS-exo-caused decrease of ATG14 protein in CACO-2 cells (Fig. 3C). This result indicates that apigenin abolished the suppression of autophagy by IBS-exos through regulating ATG14.

Fig. 3
figure 3

Apigenin dose-dependently promoted autophagy of CACO-2 cells that were co-cultured with IBS-exos. A, B IMF staining of LC3 was used to examine the autophagy of CACO-2 cells. ***p <0.01 vs control; ###p <0.001 vs IBS-exo. C ATG14 expression levels

Full size image

miR-148b-3p bound 3′UTR of ATG14 to suppress its expression

We further investigated the potential mechanisms by which apigenin promote autophagy of CACO-2 cells. By searching available data bank, we speculated ATG14 was a target of miR-148b-3p. So, we transfected CACO-2 cells with miR-148b-3p miNC, inhibitor, or mimic. QRT-PCR results indicated that transfection of miR-148b-3p inhibitor increased ATG14, while miR-148b-3p mimic decreased ATG14 (Fig. 4A). Transfection of miR-148b-3p mimic also decreased ATG14, while transfection of miR-148b-3p inhibitor increased ATG14 at protein level (Fig. 4B). Dual-luciferase reporter assay also confirmed the binding of has-miR-148b-3p and ATG14. Together, these findings indicated that miR-148b-3p suppressed ATG14 transcription through the binding on its 3′UTR.

Fig. 4
figure 4

miR-148b-3p suppressed ATG14 via binding to 3′UTR. A Levels of miR-148b-3p and ATG14. B Protein levels of ATG14. C has-miR-148b-3p binding sites and corresponding mutation. D Dual-luciferase reporter gene verification of the binding of has-miR-148b-3p and ATG14. ***p <0.001 vs miNC

Full size image

Overexpressing ATG14 promoted CACO-2 autophagy in the presence of miR-148b-3p mimic

To study the role of ATG14/miR-148b-3p in autophagy, ATG14 was successfully overexpressed in CACO-2 cells (Fig. 5A, B). IMF staining results indicated that overexpression of ATG14 abolished miR-148b-3p mimic caused autophagy of CACO-2 cells (Fig. 5C). Then, we examined the relative protein levels of ATG14. Western blots showed that overexpression of ATG14 reversed miR-148b-3p mimic caused a decrease of ATG14 (Fig. 5D). These results indicated that ATG14 overexpression promoted CACO-2 autophagy in the presence of miR-148b-3p mimic.

Fig. 5
figure 5

ATG14 overexpression promoted CACO-2 autophagy in the presence of miR-148b-3p mimic. A, B Relative mRNA and protein levels of ATG14 in CACO-2 cells after overexpressing ATG14. ***p < 0.001 vs oeNC. C Overexpression of ATG14 abolished miR-148b-3p mimic caused autophagy of CACO-2 cells. ***p < 0.001 vs miNC; ###p < 0.001 vs mimic. D Protein levels of ATG14 in CACO-2 cells after transfecting with oeNC or oeATG14 in the presence of miR-148b-3p mimic

Full size image

ATG14 overexpression promoted the autophagy of CACO-2 cells in the presence of miR-148b-3p mimic through increasing ATG14

To study the underlying mechanism by which ATG14 overexpression promoted CACO-2 autophagy, CACO-2 cells were treated by miR-148-3p mimic in the presence of apigenin. Results showed that apigenin promoted the autophagy of CACO-2 after co-cultured with miR-148-3p mimic (Fig. 6A, B). Q-PCR results indicated that apigenin did not affect miR-148b-3p in CACO-2 cells after co-cultured with miR-148b-3p mimic (Fig. 6C). However, apigenin treatment enhanced the protein level of ATG14 in CACO-2 cells in the presence of miR-148-3p mimic (Fig. 6D). Together, the data suggested that ATG14 overexpression promoted CACO-2 autophagy in the presence of miR-148b-3p mimic.

Fig. 6
figure 6

Overexpressing ATG14 promoted CACO-2 autophagy in the presence of miR-148b-3p mimic through increasing ATG14. A, B Apigenin promoted the autophagy of CACO-2 after co-cultured with miR-148-3p mimic. **p < 0.01 vs miNC; ###p < 0.001 vs mimic. C Apigenin did not affect miR-148b-3p in CACO-2 cells after co-cultured with miR-148b-3p mimic. D Apigenin treatment enhanced the protein level of ATG14 in CACO-2 cells in the presence of miR-148-3p mimic

Full size image

Discussion

In this study, IBS-exos were successfully isolated and used to treat CACO-2 cells. We demonstrated that IBS-exos decreased the autophagy in CACO-2 cells. Administration of apigenin dose-dependently abolished the inhibitory effect of IBS-exo on CACO-2 autophagy. A mechanistic study indicated that miR-148b-3p suppressed ATG14 to suppress autophagy through the binding to its 3′UTR. In contrast, ATG14 overexpression promoted the autophagy of CACO-2 cells in the presence of miR-148b-3p mimic. These results identified a novel role of miR-148b-3p/ATG14 in CACO-2 autophagy and may facilitate the development of new drugs for IBS.

Apigenin plays a role in various diseases. For example, Malik et al. have demonstrated that apigenin ameliorated STZ-induced diabetic nephropathy [32]. Anusha et al. have reported that apigenin has a protective Parkinson’s disease via suppression of ROS-mediated apoptosis [33]. Apigenin has also been shown to suppress lupus [34]. The results indicate a key role of apigenin in the regulation of CACO-2 cell autophagy, showing for the first time that apigenin dose-dependently abolished the inhibitory effect of IBS-exos on the autophagy of CACO-2 cells.

miRNAs are small, noncoding RNA (21–25 nucleotides) that regulate gene expression [35]. Studies have shown that miRNA dysregulation regulates different biological processes [36, 37]. Kim et al. indicated that miR-148b-3p regulates angiogenesis and is a therapeutic candidate for overcoming endothelial cell dysfunction and angiogenic disorders [38]. Arambula-Meraz et al. have observed a correlation between miR-148b-3p with two established biomarkers of prostate cancer, PSA and PCA3, suggesting its potential as a biomarker of prostate cancer [39]. MiR-148b-3p has also been shown to inhibit the pro-angiogenic phenotype of endothelial cells [40]. This study further explored its biological function. We showed miR-148b-3p suppressed the transcription of ATG14 to suppress autophagy of CACO-2 cells through binding to its 3′UTR. These findings indicated a new function of miR-148b-3p in IBS, showing miR-148b-3p inhibited the autophagy of CACO-2 cells by suppressing ATG14 transcription through binding to its 3′UTR.

Our results indicated that miR-148b-3p bound directly to the 3′UTR of ATG14 promoter to negatively regulated ATG14 expression, which was verified by the facts that overexpressing ATG14 abolished miR-148b-3p-caused suppression of CACO-2 autophagy. The findings demonstrate for the first time that miR-148b-3p targets ATG14, and highlight the importance of miR-148b-3p/ATG14 signaling axis in human colon epithelial cells and IBS. Future studies in animals will provide more relevant data. Although shortcomings exist, this study demonstrated a new role of apigenin in the autophagy of CACO-2 cells.

Conclusion

This study demonstrated a new function of apigenin in the autophagy of human colon epithelial cells, showing that apigenin dose-dependently abolished the inhibitory effects of IBS-exo on CACO-2 autophagy by regulating miR-148b-3p/ATG14 signaling.

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

References

  1. Canavan C, West J, Card T. The epidemiology of irritable bowel syndrome. Clin Epidemiol. 2014;6:71–80.

    PubMed  PubMed Central  Google Scholar 

  2. Lovell RM, Ford AC. Global prevalence of and risk factors for irritable bowel syndrome: a meta-analysis. Clin Gastroenterol Hepatol. 2012;10(7):712–721 e714.

    Article  PubMed  Google Scholar 

  3. Whitehead WE, Burnett CK, Cook EW 3rd, Taub E. Impact of irritable bowel syndrome on quality of life. Dig Dis Sci. 1996;41(11):2248–53.

    Article  CAS  PubMed  Google Scholar 

  4. Occhipinti K, Smith JW. Irritable bowel syndrome: a review and update. Clin Colon Rectal Surg. 2012;25(1):46–52.

    Article  PubMed  PubMed Central  Google Scholar 

  5. Hostetler GL, Ralston RA, Schwartz SJ. Flavones: food sources bioavailability, metabolism, and bioactivity. Adv Nutr. 2017;8(3):423–35.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  6. Papay ZE, Kosa A, Boddi B, Merchant Z, Saleem IY, Zariwala MG, et al. Study on the pulmonary delivery system of apigenin-loaded albumin nanocarriers with antioxidant activity. J Aerosol Med Pulm Drug Deliv. 2017;30(4):274–88.

    Article  CAS  PubMed  Google Scholar 

  7. Wang YC, Huang KM. In vitro anti-inflammatory effect of apigenin in the Helicobacter pylori-infected gastric adenocarcinoma cells. Food Chem Toxicol. 2013;53:376–83.

    Article  CAS  PubMed  Google Scholar 

  8. Yan X, Qi M, Li P, Zhan Y, Shao H. Apigenin in cancer therapy: anti-cancer effects and mechanisms of action. Cell Biosci. 2017;7:50.

    Article  PubMed  PubMed Central  Google Scholar 

  9. Zhang X, Bu H, Jiang Y, Sun G, Jiang R, Huang X, et al. The antidepressant effects of apigenin are associated with the promotion of autophagy via the mTOR/AMPK/ULK1 pathway. Mol Med Rep. 2019;20(3):2867–74.

    CAS  PubMed  Google Scholar 

  10. Mascaraque C, Gonzalez R, Suarez MD, Zarzuelo A, Sanchez de Medina F, Martinez-Augustin O. Intestinal anti-inflammatory activity of apigenin K in two rat colitis models induced by trinitrobenzenesulfonic acid and dextran sulphate sodium. Br J Nutr. 2015;113(4):618–26.

    Article  CAS  PubMed  Google Scholar 

  11. Lin J, Li J, Huang B, Liu J, Chen X, Chen XM, et al. Exosomes: novel biomarkers for clinical diagnosis. TheScientificWorldJournal. 2015;2015:657086.

    Article  PubMed  PubMed Central  Google Scholar 

  12. Kalluri R, LeBleu VS. The biology, function, and biomedical applications of exosomes. Science. 2020;367(6478):eaau6977. https://doi.org/10.1126/science.aau6977.

  13. Lin Y, Anderson JD, Rahnama LMA, Gu SV, Knowlton AA. Exosomes in disease and regeneration: biological functions, diagnostics, and beneficial effects. Am J Physiol Heart Circ Physiol. 2020;319(6):H1162–80.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  14. Isola AL, Chen S. Exosomes: the messengers of health and disease. Curr Neuropharmacol. 2017;15(1):157–65.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  15. Lai RC, Arslan F, Lee MM, Sze NS, Choo A, Chen TS, et al. Exosome secreted by MSC reduces myocardial ischemia/reperfusion injury. Stem Cell Res. 2010;4(3):214–22.

    Article  CAS  PubMed  Google Scholar 

  16. Gallet R, Dawkins J, Valle J, Simsolo E, de Couto G, Middleton R, et al. Exosomes secreted by cardiosphere-derived cells reduce scarring, attenuate adverse remodelling, and improve function in acute and chronic porcine myocardial infarction. Eur Heart J. 2017;38(3):201–11.

    CAS  PubMed  Google Scholar 

  17. Chang NC. Autophagy and stem cells: self-eating for self-renewal. Front Cell Dev Biol. 2020;8:138.

    Article  PubMed  PubMed Central  Google Scholar 

  18. Levine B, Klionsky DJ. Development by self-digestion: molecular mechanisms and biological functions of autophagy. Dev Cell. 2004;6(4):463–77.

    Article  CAS  PubMed  Google Scholar 

  19. Yorimitsu T, Klionsky DJ. Autophagy: molecular machinery for self-eating. Cell Death Differ. 2005;12(Suppl 2):1542–52.

    Article  CAS  PubMed  Google Scholar 

  20. Cuervo AM. Autophagy: in sickness and in health. Trends Cell Biol. 2004;14(2):70–7.

    Article  PubMed  Google Scholar 

  21. Shintani T, Klionsky DJ. Autophagy in health and disease: a double-edged sword. Science. 2004;306(5698):990–5.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  22. Iida T, Onodera K, Nakase H. Role of autophagy in the pathogenesis of inflammatory bowel disease. World J Gastroenterol. 2017;23(11):1944–53.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  23. Hu CA, Hou Y, Yi D, Qiu Y, Wu G, Kong X, et al. Autophagy and tight junction proteins in the intestine and intestinal diseases. Anim Nutr. 2015;1(3):123–7.

    Article  PubMed  PubMed Central  Google Scholar 

  24. Lin R, Jiang Y, Zhao XY, Guan Y, Qian W, Fu XC, et al. Four types of Bifidobacteria trigger autophagy response in intestinal epithelial cells. J Dig Dis. 2014;15(11):597–605.

    Article  CAS  PubMed  Google Scholar 

  25. Sun M, Zhai M, Zhang N, Wang R, Liang H, Han Q, et al. MicroRNA-148b-3p is involved in regulating hypoxia/reoxygenation-induced injury of cardiomyocytes in vitro through modulating SIRT7/p53 signaling. Chem Biol Interact. 2018;296:211–9.

    Article  CAS  PubMed  Google Scholar 

  26. Gao B, Wang D, Sun W, Meng X, Zhang W, Xue D. Differentially expressed microRNA identification and target gene function analysis in starvation-induced autophagy of AR42J pancreatic acinar cells. Mol Med Rep. 2016;14(1):590–8.

    Article  CAS  PubMed  Google Scholar 

  27. Miao B, Qi WJ, Zhang SW, Wang H, Wang C, Hu L, et al. miR-148a suppresses autophagy by down-regulation of IL-6/STAT3 signaling in cerulein-induced acute pancreatitis. Pancreatology. 2019;19(4):557–65.

    Article  CAS  PubMed  Google Scholar 

  28. Obara K, Sekito T, Ohsumi Y. Assortment of phosphatidylinositol 3-kinase complexes--Atg14p directs association of complex I to the pre-autophagosomal structure in Saccharomyces cerevisiae. Mol Biol Cell. 2006;17(4):1527–39.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  29. Xiong X, Tao R, DePinho RA, Dong XC. The autophagy-related gene 14 (Atg14) is regulated by forkhead box O transcription factors and circadian rhythms and plays a critical role in hepatic autophagy and lipid metabolism. J Biol Chem. 2012;287(46):39107–14.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  30. Diao J, Liu R, Rong Y, Zhao M, Zhang J, Lai Y, et al. ATG14 promotes membrane tethering and fusion of autophagosomes to endolysosomes. Nature. 2015;520(7548):563–6.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  31. Zhu W, Huang L, Li Y, Zhang X, Gu J, Yan Y, et al. Exosomes derived from human bone marrow mesenchymal stem cells promote tumor growth in vivo. Cancer Lett. 2012;315(1):28–37.

    Article  CAS  PubMed  Google Scholar 

  32. Malik S, Suchal K, Khan SI, et al. Apigenin ameliorates streptozotocin-induced diabetic nephropathy in rats via MAPK-NF-kappaB-TNF-alpha and TGF-beta1-MAPK-fibronectin pathways. Am J Physiol Renal Physiol. 2017;313(2):F414–22.

    Article  CAS  PubMed  Google Scholar 

  33. Anusha C, Sumathi T, Joseph LD. Protective role of apigenin on rotenone induced rat model of Parkinson’s disease: suppression of neuroinflammation and oxidative stress mediated apoptosis. Chem Biol Interact. 2017;269:67–79.

    Article  CAS  PubMed  Google Scholar 

  34. Kang HK, Ecklund D, Liu M, Datta SK. Apigenin, a non-mutagenic dietary flavonoid, suppresses lupus by inhibiting autoantigen presentation for expansion of autoreactive Th1 and Th17 cells. Arthritis Res Ther. 2009;11(2):R59.

    Article  PubMed  PubMed Central  Google Scholar 

  35. Li G, Sun L, Mu Z, et al. MicroRNA-1298-5p inhibits cell proliferation and the invasiveness of bladder cancer cells via down-regulation of connexin 43. Biochem Cell Biol. 2020;98(2):227–37.

    Article  CAS  PubMed  Google Scholar 

  36. Wang CM, Cheng BH, Xue QJ, Chen J, Bai B. MiR-1298 affects cell proliferation and apoptosis in C6 cells by targeting SET domain containing 7. Int J Immunopathol Pharmacol. 2017;30(3):264–71.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  37. Cai G, Qiao S, Chen K. Suppression of miR-221 inhibits glioma cells proliferation and invasion via targeting SEMA3B. Biol Res. 2015;48:37.

    Article  PubMed  PubMed Central  Google Scholar 

  38. Kim H, Ko Y, Park H, et al. MicroRNA-148a/b-3p regulates angiogenesis by targeting neuropilin-1 in endothelial cells. Exp Mol Med. 2019;51(11):1–11.

    PubMed  PubMed Central  Google Scholar 

  39. Arambula-Meraz E, Bergez-Hernandez F, Leal-Leon E, et al. Expression of miR-148b-3p is correlated with overexpression of biomarkers in prostate cancer. Genet Mol Biol. 2020;43(1):e20180330.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  40. Zhang H, Ye Q, Du Z, Huang M, Zhang M, Tan H. MiR-148b-3p inhibits renal carcinoma cell growth and pro-angiogenic phenotype of endothelial cell potentially by modulating FGF2. Biomed Pharmacother. 2018;107:359–67.

    Article  CAS  PubMed  Google Scholar 

Download references

Acknowledgements

We sincerely acknowledged the support given by the Department of Gastroenterology, Tongde Hospital of Zhejiang Province, Hangzhou, Zhejiang 310012, P.R. China.

Code availability

Not applicable

Funding

This research was financially supported by Zhejiang Provincial Natural Science Foundation of China (No. LQ19H270007 and No. LY21H270003), and Zhejiang Province project of traditional Chinese medicine (No. 2021ZA035).

Author information

Authors and Affiliations

  1. Department of Gastroenterology, Tongde Hospital of Zhejiang Province, Gucui Road 234, Xihu District, Hangzhou, Zhejiang, 310012, People’s Republic of China

    Rui Fu, Saiyue Liu, Jiajie Zhu & Mingxian Chen

  2. Department of Adverse Drug Reaction Monitoring, Zhejiang Province Center of Adverse Drug Reaction Monitoring, Hangzhou, Zhejiang, 310012, People’s Republic of China

    Mingjin Zhu

Authors
  1. Rui Fu
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Saiyue Liu
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Mingjin Zhu
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Jiajie Zhu
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Mingxian Chen
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

MC designed the project and revised the manuscript. RF performed the experiments and drafted the manuscript. SL and MZ analyzed the data and edited the figures. JZ provided technical assistance. All authors read and approved the final manuscript.

Corresponding author

Correspondence to Mingxian Chen.

Ethics declarations

Ethics approval and consent to participate

The study was approved by the Ethics Committee of Tongde Hospital of Zhejiang Province.

Consent for publication

Not applicable

Competing interests

The authors declare no competing interests.

Additional information

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and Permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Fu, R., Liu, S., Zhu, M. et al. Apigenin reduces the suppressive effect of exosomes derived from irritable bowel syndrome patients on the autophagy of human colon epithelial cells by promoting ATG14. World J Surg Onc 21, 95 (2023). https://doi.org/10.1186/s12957-023-02963-5

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s12957-023-02963-5

Keywords

  • Apigenin
  • Exosome
  • Irritable bowel syndrome
  • Autophagy
  • MicroRNA

World Journal of Surgical Oncology

ISSN: 1477-7819

Contact us