Skip to main content

Table 1 Sequence of primers used in Parkinson’s disease gene mRNA real-time q-PCR

From: Status of the Parkinson’s disease gene family expression in non-small-cell lung cancer

Primer GeneBank ID Sequence forward (5′–3′) Sequence reverse (5′–3′) Product (bp)
PARK1/4 SCNA NM000345.3 AAACCAAGGAGGGAGTGGTG CTGTCTTCTGGGCTACTGCTG 117
PARK2 Parkin AB009973.1 CTGACACCAGCATCTTCCAG CCAGTCATTCCTCAGCTCCT 107
PARK5 UCHL1 BC000332.2 GCCAATGTCGGGTAGATGAC AGCGGACTTCTCCTTGCTC 192
PARK6 PINK1 AB053323.1 CAAGAGAGGTCCCAAGCAAC GGCAGCACATCAGGGTAGTC 117
PARK7 DJ-1 D61380.2 TGGCTAAAGGAGCAGAGGAA ATGACCACATCACGGCTACA 127
PARK8 LRRK2 AY792511.1 GAGCACGCCTCCAAGTTATT AGAAGTGACCAACCCACCTG 110
PARK9 ATP13A2 AL354615.1 TGGCTGGCTGACCACTACTAC AGTCTGGCTTTGCTTTCTGG 102
PARK15 FBXO7 AF233225.1 TACCCGACAAGCACTGAACC AAGACGGAACGAACATCCAG 102
GBA D13286.1 CTTCTGCTGGGCTGTTGAGT TACTGTTGGCGAGGGTAGGA 108
β2-microglobulin NM004048.2 ACCCCCACTGAAAAAGATGA ATCTTCAAACCTCCATGATG 114