Skip to main content

Table 1 Primer sequences

From: Expression levels and clinical values of miR-92b-3p in breast cancer

Primers Positive primers Reverse primers
miR-92b-3p ACACTCCAGCTGGGTATTGCACTCGTCCCGGC TCTCAACTGGTGTCGTGGAGTCGGCAATTCAGT
U6 CTCGCTTCGGCAGCACA AACGCTTCACGAATTTGCGT