Skip to main content

Table 1 RCR reaction primer sequence

From: The expression of the GATA6 gene in oral carcinoma cell lines

Name of the primer Primer sequences(5′→3′)
GATA6-1-Fw CTCAGTTCCTACGCTTCGCAT
GATA6-1-Rv GTCGAGGTCAGTGAACAGCA
GATA6-2-Fw CTGCGGGCTCTACAGCAAG
GATA6-2-Rv GTTGGCACAGGACAATCCAAG
GATA6-3-Fw GTGCCAACTGTCACACCACA
GATA6-3-Rv GAGTCCACAAGCATTGCACAC
β-actin-Fw CATGTACGTTGCTATCCAGGC
β-actin-Rv CTCCTTAATGTCACGCACGAT