Skip to main content

Table 2 Sequences of primers and oligos

From: Identification and validation of three core genes in p53 signaling pathway in hepatitis B virus-related hepatocellular carcinoma

Gene name Forward Reverse
GAPDH CCATGGGGAAGGTGAAGGTC GAAGGGGTCATTGATGGCAAC
CCNB1 GTGGATGCAGAAGATGGAGC CCGACCCAGTAGGTATTTTGG
CDK1 AGGAAGGGGTTCCTAGTACTGC TGGAATCCTGCATAAGCACA
RRM2 TCTATGGCTTCCAAATTGCC GACACAAGGCATCGTTTCAA
p53 TAACAGTTCCTGCATGGGCGGC AGGACAGGCACAAACACGCACC
p21 TGGAGACTCTCAGGGTCGAA GGATTAGGGCTTCCTCTTGG