Skip to main content

Table 1 The primer sequences for qRT-PCR in this study

From: Circ_DOCK1 regulates USP11 through miR-132-3p to control colorectal cancer progression

Name Sequence (5′-3′)
Forward Reverse
miR-132-3p GCCGAGTAACAGTCTACAGCC AGTGCAGGGTCCGAGGTATT
U6 TTCCTCCGCAAGGATGACACGC GTGCAGGGTCCGAGGT
circ_DOCK1 CATTTCCATGGGACGAGATT CCTCGGTACCACCCTTCATA
DOCK1 TATGAAGGGTGGTACCGAGG TAGAGCTGCCTCCAGATGGT
USP11 TTCCACGGCCTCTTCAAGTC CGCGGATCCATGGGGATAAA
GAPDH AATGGGCAGCCGTTAGGAAA GCGCCCAATACGACCAAATC