Skip to main content

Table 1 Primers used in qRT-PCR

From: BRAFV600E mutation, BRAF-activated long non-coding RNA and miR-9 expression in papillary thyroid carcinoma, and their association with clinicopathological features

Primer Sequence (5′→3′) Size of target fragment (bp)
BANCR-F CCCCTGACCCTAAGGAAATA 150
BANCR-R GAACTGGCAAGGCTCAAACT  
β-actin-F CTTAGTTGCGTTACACCCTTTCTTG 156
β-actin-R CTGTCACCTTCACCGTTCCAGTTT  
miR-9-5p-F CGCCGCTCTTTGGTTATCTAG 63
miR-9-5p-R GTGCAGGGTCCGAGGTATTC  
5S-F TCTCGTCTGATCTCGGAAGC 125
5S-R TGGTGCAGGGTCCGAGGTAT