Skip to main content

Table 1 Primers and primer sequences of Q-PCR genes

From: Identification of key differentially expressed genes and gene mutations in breast ductal carcinoma in situ using RNA-seq analysis

PrimerSequence(5′–3′)
RWDD4-hFTGCCAACGAGGACCAGGAG
RWDD4-hRAGGCTTTGGGATCACCATTTT
SDHC-hFTGCCTCCGAGCCCACTTTA
SDHC-hRTTATTCCAGAACCGCTCCATC
SEPT7-hFAGGAGCGTCAACAGCAGCAC
SEPT7-hRCCCAATCCAGATTCACCCACT
SFN-hFGCCGAACGCTATGAGGACA
SFN-hRGCTCAATACTGGACAGCACCC
GAPDH-hFTGACAACTTTGGTATCGTGGAAGG
GAPDH-hRAGGCAGGGATGATGTTCTGGAGAG