Skip to main content

Table 1 General characteristics of genetic variants in long non-coding RNA genes

From: rs1859168 A > C polymorphism regulates HOTTIP expression and reduces risk of pancreatic cancer in a Chinese population

Gene SNP Chr: position MAF HWE Primers
HOTTIP rs1859168 Chr7: 27,202,740 A = 0.131 0.099 Sense: ACGTTGGATGAATGATAGGGACACATCGGG
      Antisense: ACGTTGGATGAGGTTTGTCTGAGAGGGATG
HOTAIR rs4759314 Chr12: 53,968,051 G = 0.095 0.166 Sense: ATGATCTGCTTGGAAGGGATATAAA
      Antisense: GCCTGGGCTTTTTCAGGTTT
H19 rs217727 Chr11: 1,995,678 T = 0.320 0.302 Sense: ACTCAGGAATCGGCTCTGGAAGGTG
      Antisense: GATGTGGTGGCTGGTGGTCAACGGT
  1. MAF minor allele frequency, HWE Hardy-Weinberg equilibrium