Skip to main content

Table 2 MS-PCR primers of specific genes analyzed in this study

From: The combination effect of sodium butyrate and 5-Aza-2'-deoxycytidine on radiosensitivity in RKO colorectal cancer and MCF-7 breast cancer cell lines

   Sense primer (5'-3') Antisense primer (5'-3')
p14ARF M GTGTTAAAGGGCGGCGTAGC AAAACCCTCACTCGCGACG
  U TTTTTGGTGTTAAAGGGTGGTGTAGT CACAAAAACCCTCACTCACAACAA
p16INK4a M TTATTAGAGGGTGGGGCGGATCGC GACCCCGAACCGCGACCGTAA
  U TTATTAGAGGGTGGGGTGGATTGT CAACCCCAAACCACAACCATA
E-cadherin M TTAGGTTAGAGGGTTATCGCGT TAACTAAAAATTCACCTACCGAC
  U TAATTTTAGGTTAGAGGGTTATTGT CACAACCAATCAACAACACA
MINT1(M1) M AATTTTTTTATATATATTTTCGAAGC AAAAACCTCAACCCCGCG
  U AATTTTTTTATATATATTTTTGAAGTGT AACAAAAAACCTCAACCCCACA
MINT2(M2) M TTGTTAAAGTGTTGAGTTCGTC AATAACGACGATTCCGTACG
  U GATTTTGTTAAAGTGTTGAGTTTGTT CAAAATAATAACAACAATTCCATACA
MINT31(M31) M TGTTGGGGAAGTGTTTTTCGGC CGAAAACGAAACGCCGCG
  U TAGATGTTGGGGAAGTGTTTTTTGGT TAAATACCCAAAAACAAAACACCACA