Skip to main content

Table 1 The primers of p53 gene and the condition of amplification

From: Malignant epithelioid angiomyolipoma of the kidney with pulmonary metastases and p53 gene mutation

Exon Amplified length (bp) Primer sequence (5′-3′) Condition of amplification
5 183 TACTCCCTGCCCCTCAACAAG 94°C, 1 minute; 55°C, 1 minute; 72°C,
   ATCGCTATCTGAGCAGCGCTC 1 minute; 48 cycles
6 114 GGTCTGGCCCCTCCTCAGCAT 94°C, 1 minute; 63°C, 1 minute;72°C,
   CTCAGGCGGCTCATAGGGCAC 1 minute; 50 cycles
7 111 GTTGGCTCTGACTGTACCACC 94°C, 1 minute; 55°C, 1 minute;72°C,
   CCTGGAGTCTTCCAGTGTGAT 1 minute; 48 cycles
8 135 TGGTAATCTACTGGGACTGAA TCGCTTAGTGCTCCCTGGGGG 94°C, 1 minute; 55°C, 1 minute; 72°C, 1 minute; 48 cycles