Skip to main content

Advertisement

Table 1 Primers used for RT-PCR

From: Different cDNA microarray patterns of gene expression reflecting changes during metastatic progression in adenoid cystic carcinoma

Gene Primers Product size
RPL29 5'ACATGGCCAAGTCCAAGAAC3' 5'TTAGGCCCTTTTTGTTGTGC3' 165
CD98 5'TCTTGATTGCGGGGACTAAC3' 5'GAGCCTTGCCTGAGACAAAC3' 197
L6 5'AGGGCCAGTACCTTCTGGAT3' 5'AAGCCACATATGCCTCCAAG3' 169
TSH 5'CGTGCCACTGCAGTACTTGT3' 5'TTGAAGCGTGTCAAAGTGGT3' 165